Medical Laboratory science

Permanent URI for this collection

http://dspace.alquds.edu:4000/handle/20.500.12213/1095

Browse

Browsing Medical Laboratory science by Title

Now showing 1 - 20 of 81
  • Thumbnail Image
    Item
    Antibiotic Resistance Patterns and Molecular Typing of Acinetobacter baumannii Clinical Isolates and Hospital Environment at Alia Governmental Hospital, Palestine
    (Al-Quds University, 2024-05-28) Donia Mohammad Mosbah Khderat; دنيا محمد مصباح خضيرات
    Background:In recent years, Acinetobacter baumanniireceived increasing attention;due to theircabability of acquiring multi-resistance to antibiotics and their potential to cause disease in humans. It is also known for its intrinsic antimicrobial resistance mechanisms: several studies documentedthe increase in the percentage of resistance to antimicrobial agents in four majorantimicrobialclasses: Fluoroquinolones,aminoglycosides, β-lactams including Carbapenems. The increase in Carbapenems resistance is of important concern, as thisclass of antibiotics isusually considered the last choice in treating resistant A.baumannii.This opportunistic pathogen able to survive in the environment under unfavorable conditions for prolonged periods,this contributes to its increased virulance. Thus, the hospital environment may serve asa reservoir for the resistantA. baumannii strainsallowing easily spread in hospital,serve as a nosocomial infections in patients, healthcare personnel, and visitors. Aims: This study aimed at characterization of A. baumanniiisolates from inpatients and hospital environments.To find out their antimicrobial resistance pattern, detect Carbapenems resistant A.baumannii(CRAB), and to find out genetic relatedness between isolates using random amplification of polymorphic DNA (RAPD) typing technique. Methodology: In this study, a total of 24 clinical isolates obtained from various clinical specimenssuch as wounds, blood, urine, earswabs and sputumduring the period April1, 2023, and December 31, 2023fromAlia Governmental Hospital, Hebron,Palestine. The Vitek2 system was used for identification and antibiotic susceptibility testing. Concurrently a total of 126 specimen were collected from different environments of the hospital identified as A. baumanniiusing conventional identification methodsand CHROMagar Acinetobacterselective medium. The isolates then tested for antibiotic susceptibility testing using disk diffusion methods.All isolates (both clinical and v environmental) were tested for the presence ofblaOXA-51 gene using PCR. And finally, the genetic relatedness between isolates was determined using RAPDtyping technique. Results:Twenty fourclinical isolates and 29 environmental isolates were identified as A. baumannii. All isolates were confirmed to be A. baumanniiby detecting blaOXA-51-like gene.Among the environmental isolates patient’s beds were the most contaminated site (20.6%, 6/29),while the largest number of clinical isolates were obtained from wounds (10 isolates: 41.7%). The majority of clinical and environmental isolates were collected from intensive care unit (ICU).Multidrug resistant A.baumannii (MDRAB) was detected in approximately 74% of clinical isolates and in 100% of environmental isolates.Co-trimoxazole (COT) was the most effective antibiotic against both clinical and environmentalA.baumannii isolates. For other antibiotics, clinical and environmentalA.baumanniiisolates showed high resistance rates:86.2% and 96.6% of environmentalisolates were resistant to imipenem (IM) and meropenem (MEM) respectively,while clinical isolates had a resistant rate of 72.7% and 77.3% to IM and MEM, respectively.Using the RAPD-PCR typing technique, four clusters grouped A-D had more than one isolateand the remaining isolates each had unique pattern. Some RAPD clusters were seen with environmental as well as clinical isolates. Conclusion and recomendations:Thisstudy clearly suggests that the rate of MDRAB and CRAB are increasing and considered an important cause of nosocomial infections.The relatednessbetween clinical and environmental isolates and the detection of high rate of antimicrobial-resistant A.baumanniiin various hospital environments suggested the potential role of the hospital environments through various clinical activities in the cross contamination of A.baumanniiinfections, particularly in the ICU. These findings highlight the importance of identifying A.baumannii infections early and implementing very strict infection control strategies.It is recommended that hospital wards must be vigorously sanitized and disinfected periodically.
  • Thumbnail Image
    Item
    Assessment of Patient Safety Culture in the Palestinian Hospital Pharmacies
    (AL-Quds University, 2011) وفاء جمال حسن الزغاري; Wafa Jamal Hassan Zaghari; معتصم حمدان; Hussein Hallak; Ali Shaar
    Background: Patient safety culture assessment in pharmacies is increasing largely worldwide, many tools that were used to assess patient safety culture at the hospital settings as a whole are now adapted to be used for pharmacies. One of the most commonly used and rigorously validated tools to measure patient safety culture is the Safety Attitudes Questionnaire (SAQ). The tool consists of 30 items that cover six safety culture domains. The intention of this research is to map the patient safety culture in the Palestinian hospital pharmacies, this will be achieved through measuring and analyzing the patient safety culture domains there, understanding factors influencing safety culture and examine variations between different hospital pharmacies. This assessment helps in determining safety culture domains that are considered as areas of strength, and safety culture domains that are considered as areas of weakness for each hospital pharmacy. Mapping patient safety culture in hospital pharmacies will end up by directing each hospital pharmacy to improve areas of weakness effectively and efficiently. Purpose: To assess patient safety culture in the Palestinian hospital pharmacies, and to assess the association of hospitals and respondents characteristics with patient safety culture. Methods: A cross-sectional design was used. The English version of the SAQ was translated and adapted to the Palestinian context. The survey was carried out in (28) Palestinian hospitals in the West Bank and East Jerusalem. All pharmacist assistants, pharmacist, and clinical pharmacists in these hospitals were targeted, estimated to 115 personnel. Items mean and scale scores were calculated. Then a composite score equivalent to the arithmetic mean of the scale scores were also calculated. In order to identify areas of strength and areas for potential improvement, the percentages of positive responses for the survey domains and items were calculated. Univariate analysis was used to test associations between composite patient safety scores and different respondent and hospital characteristics. viii Findings: 73 persons participated in the study, response rate was 68.8%. Females were 66.7%, 51% were pharmacist or clinical pharmacist, and 84.7% were with experience ≥ 5 years in profession. Two SAQ domains, job satisfaction and working conditions, were identified as areas of strength and received ≥75% of positive responses. Patient safety level was graded as “accepted” by (50%) of the respondents and none gave their pharmacy a “Poor” or “Failing” grade. Event reporting was very low, (66%) of the respondents didn’t report any event in the past year. In regard to the associations between safety culture domains scores with participants and hospital characteristics, the association was statistically significant (P<0.05) in regard to hospital ownership with the teamwork climate (P=0.02), perception of management (P=0.03), job satisfaction (P=0.001), and working conditions (P=0.02) and all in favor of the private and NGO hospitals. Participants working in hospitals sized <50 beds were more positive towards perception of management climate than their counterparts in larger sized hospitals (P=0.031). The overall safety score was significantly associated only with the hospital ownership (P=0.002) in favor of the private and NGO hospitals. No statistically significant associations were found between safety culture domains and the participant’s age, gender, years of experience in profession and hospital, level of education, working hours, and job title. The safety culture domain scores varied largely among different hospital pharmacies. None of the six domains were positive for four hospitals, twelve hospitals have negative total safety score and the best result was having five positive safety domains and a positive total safety score and this result was achieved only by two hospitals. Conclusions: Safety culture assessment results revealed areas for potential improvement in Palestinian hospital pharmacies. Hospitals need to formulate specific patient safety culture interventions to address these weaknesses
  • Thumbnail Image
    Item
    Cloning and Expression of SARS CoV-2 Surface Protein and its Use in Serological Tests
    (Al-Quds University, 2022-05-28) Hana Ghalib Sabri Alkhatib; هناء غالب صبري الخطيب
    مقدمة: يعتبر فايروس كورونا المسبب الرئيسي لمرض التنفس الحاد كورونا 2019، الذي غزا العالم في غضون اشهر قليلة، وسبب عدد اصابات و وفيات عالي جدا، و أثر على العالم اجمع بشكل سلبي. الفحوصات المصلية مهمة جدا لتشخيص المرضى المصابين بهذا المرض، والحاملين له من غير أي أعراض بهدف الكشف عنهم و الحد من انتشار المرض بشكل أوسع، بالاضافة لعمل فحوصات تبين قوة و نوع المناعة التي يحفزها جسم الانسان لمحاربة هذا النوع من الفايروسات، و عليه الهدف الاساسي من هذه الدراسة هو تطوير الفحص المناعي المرتبط بالانزيم (الاليزا) للكشف عن وجود أجسام مضادة الناتجة عن الأصابة بفايروس كورونا 2019 المسبب لهذا المرض. طرق البحث: تم تصميم وتأسيس اختبار مصلي بطريقة الاليزا للكشف عن الأجسام المضادة ضد فايروس كورونا 2019 وذلك من خلال استنساخ جين البروتين الخارجي المدبب للفايروس واضافته للمادة الوراثية الخاصة في البكتيريا بهدف ترجم الجين الى لبروتين و الحصول عليه واستخدامه في الكشف عن الاجسام المضادة في الاليزا المطورة، بحيث تم فحص المناعة الجسدية لكل من مرضى مصابين حاليا او سابقا او حاصلين على تطعيم الكورونا. النتائج: أظهرت نتائج الفحص المطوّر لقياس المناعة حساسيّة الكشف عن الأجسام المضادّة بتراكيز منخفضة دليل على نجاح الفحص المناعي المطوّر من خلال استنساخ البروتين الشوكي لفايروس كورونا 2019 ، بالاضافة الى التمييز بين نسختين مختلفتين من البروتين الشوكي حسب القطع الجينيّة المستنسخة، بحيث تبين أن المستنسخ رقم 8 يعطي حساسية أكبر وأفضل من مستنسخ رقم 105 في الكشف عن المناعة ضد الفايروس. الاستنتاج: كان لدى الفحص المطوّر حساسية عالية وقدرة على تحديد كميّة و نوعيّة للأجسام المضادّة لفايروس كورونا 2019 بتراكيز منخفضة ويعتبر هذا الاختبار طريقة لقياس مناعة السكّان ويمكن استخدامه لاجراء دراسات وبائيّة مستقبلية.
  • Thumbnail Image
    Item
    Comparison between cultivation and 16s RNA sequencing based- approaches analysis for bacteria in urine and cerebrospinal fluid.
    (Al-Quds University, 2022-05-28) Amal Eissa Khader Abuhilal; امل عيسى خضر ابوهلال
    . يعتبر اختيار الطريقة الامثل والاكثر دقة وحساسية في الكشف عن البكتيريا من أهم التحديات في علم الاحياء الدقيقة ، وخصوصا في حالات الطوارئ والامراض المنتشرة والمعدية . يتم في مختبرات المستشفيات جمع عينات (كالدم وسوائل الجسم) من المرضى وفي هذه الدراسة تم التركيز على عينات البول و عينات سائل النخاع الشوكي ، وتعتبر من اهم العينات التي تساعد في الكشف عن حالة المرضى ،لا سيما عندما تكون الاعراض غير واضحة لدى الاطباء وخاصة عند الاطفال وكبار السن ، لان اغلب الطرق تفشل في تحديد مسبب المرض . تمثل الاصابة بمرض التهاب السحايا البكتيري ، من الامراض التي تهدد حياة الانسان ويمكن ان تؤدي الى الوفاة او حصول مضاعفات تؤثر على حياة الانسان ، ولذلك يجب اختيار طريقة لتشخيص هذه البكتيريا باسرع وقت وتحديد العلاج المناسب لها. فحص زراعة البكتيريا يعتبر من الطرق التقليدية للكشف عن البكتيريا ، ويمتلك العديد من التحديات كطريقة جمع العينات ،حجم العينة، الوقت المستهلك لزراعة العينة وظهور النتائج ومقاومة بعض السلالات البكتيرية للمضادات الحيوية بالاضافة الى السلالات التي لا يمكن زراعتها في المختبر. ان الهدف الرئيس لهذه الدراسة هو ايجاد طرق تشخيصية جديدة ذات دقة وحساسية عالية للكشف عن العدوى البكتيرية في عينات البول وسائل النخاع الشوكي ومقارنتها بالطرق التقليدية. تم مقارنة طريقة زراعة البكتيريا التقليدية (الكلاسيكية ) مع تقنية( ن جي اس ) والتي تعتمد على الجيل التالي من تحديد الحمض النووي للكشف عن معظم الخلايا البكتيرية في العينات المجموعة. إن تقنية الجيل القادم من تحديد تسلسل الحمض النووي (NGS) ، هي تقنية جديدة نسبيا تسمح بتحديد شامل لتسلسل الحمض النووي وتمكن من انتاج مجموعة من المعلومات الوراثية من الكائنات الحية بشكل متوازي وتوفر قياسا كميا مفصلا لكل جزء من اجزاء DNA المتسلسلة ، حيث تم استخدام بادئات ترتبط على هذه التسلسلات لزيادة اعداد مقاطع الجينات) ( 16S rRNAلانواع البكتيرية. تمت هذه الدراسة، بعد جمع 50 عينة بول (30 عينة ايجابية الاصابة بالبكتيريا، 15 عينة لا نمو كبيرعليها و 5 عينة سلبية الاصابة بالبكتيريا) و 14 عينة من سائل النخاع الشوكي)4عينات ايجابية الاصابة بالبكتيريا و 10 عينات سلبية الاصابة بالبكتيريا) من مختبر الأحياء الدقيقة في مستشفى المقاصد - القدس - فلسطين. تم جمع نتائج الزراعة البكتيرية من نفس مختبر مستشفى المقاصد . وقد تم استخراج عينة من الحمض النووي( DNA)في مختبرات جامعة القدس، وبعد ذلك تم تحليل تسلسل الحمض النووي (DNA ) بموائمة احدى الطرق المستخدمة ضمن استراتيجيات شركة Illumina MiSeqلتحليل الحمض النووي DNA . تم إجراء ما مجموعه 64 عينة تم تجميعها وفق الجيل التالي (NGS). لاحقا تم الحصول على البيانات كملفات FASTQ ثم تم تحويلها الى ملفات FASTA ثم تم تحليلها وفقا للتصنيف البكتيري للجنس والأنواع، حيث يستند الى طول التسلسل . تمكنا في هذه الدراسة ، اولا : من تحديد أنواع البكتيريا المسببة لالتهاب المسالك البولية لدى الانسان ، الموجودة في عينات البول وأهم الأنواع التي تم تحديدها وهي : Escherichia coli, Pseudomonas, Klebsiella, Lactobacillus, Enterobacter, streptococcus Group B, Acinetobacter, Staphylococcus, Rickettsia and Gardnerella. هذه الأنواع موجودة كبكتيريا مسببة للأمراض في المسالك البولية لدى الانسان، والأكثر وفرة وأهمية هي أنواعEscherichia coliالتي تسبب التهاب المسالك البولية، حيث ظهرت هذه البكتيريا في كلا الطريقتين الحديثة والتقليدية. ثانيا : اهم الانواع التي تم الكشف عنها في عينات سائل النخاع الشوكي (CSF) ، وهي : Pseudomonas, Enterobacter, Escherichia, Staphylococcus and Lactobacillus. تعتبرStaphylococcus haemolyticus من اكثر انواع البكتيريا وفرة في عينات سائل النخاع الشوكي التي تم جمعها والتي تتسب بحدوث اللاتهابات في الجهاز العصبي . وايضا ظهرت هذه البكتيريا في كلتا الطريقتين. وفي الختام ، تعتبر NGSطريقة سريعة وحساسة جدا وطريقة خاصة نستطيع من خلالها الكشف عن انواع البكتيريا التي يصعب كشفها بالطرق التلقليدية : كالبكتيريا بطيئة النمو و الانتهازية و يمكنها الكشف عن خلايا البكتيرية قليلة التركيز في العينات حيث تصل دقتها للكشف عن خلية واحدة في العينة.
  • Thumbnail Image
    Item
    Correlation between protease activated receptor (part1) polymorphism and recurrent abortion in Palestine
    (AL-Quds University, 2010-08-07) مرفت محمود سعيد ابوغزاله; MIRVAT MAHMOUD SAID ABU-GHAZALEH; زيدون صلاح; محمود سرور
  • Thumbnail Image
    Item
    Detection of Extended-Spectrum Beta-Lactamases (ESBL) production in Pseudomonas aeruginosa from various clinical samples.
    (Al-Quds University, 2022-04-16) Dana Naim Jabra Sam'an; دانا نعيم جبرا سمعان
    خلفية الدراسة: يعتبر إنتاج انزيماتالبيتا لاكتاميز آلية المقاومة البكتيرية الأكثر شيوعًا في العديد منأجناس عائلة البكتيريا المعوية. يتم ترميز هذه الإنزيمات بواسطة الجينات المحمولة على الكروموسومات أو الجينات الموجودة على العناصر المتحركة. إن الإبلاغ عن بكتيريا الزائفة الزنجاريةالمنتجة لانزيمات ESBL متزايد مؤخرًا والتي يتم إكتسابها إما من المستشفيات أو من المجتمعات. هدف الدراسة: كان الهدف الأساسي من هذه الدراسة هو الكشف عن انتشار بكتيريا الزائفة الزنجارية المنتجة لانزيمات ESBL المعزولة من العينات السريرية المختلفة المأخوذة من المستشفيات الفلسطينية في منطقة الضفة الغربية. تم عمل ذلك باستخدام اختبار تآزر القرص المزدوج المظهر ويليه تفاعل البلمرة المتسلسلالمتعدد. منهجية البحث: تم جمع 163 عزلة بكتيرية من خمسة مستشفيات في الضفة الغربية، فلسطين وتشمل مستشفى جمعية بيت لحم العربية للتأهيل/ بيت جالا، ومستشفى بيت جالا الحكومي/ بيت جالا، ومستشفى الاستشاري العربي/ رام الله، والمستشفى الأهلي/ الخليل، ومستشفى المقاصد/ القدس. تم تعريف العزلات البكتيرية على أنها بكتيريا الزائفة الزنجارية بالاعتماد على شكل المستعمرة و باستخدام الاختبارات التأكيدية البيوكيميائية. تم تطبيق اختبار تآزر القرص المزدوج للكشف عن العزلات المنتجة لانزيمات ESBL. إضافة الى ذلكتم فحص انتاج AmpCفي العزلات وتلاه عمل تفاعل البلمرة المتسلسل لاكتشاف وجود الجيناتblaCTX-M، و blaSHV، وblaTEM. النتائج: من 163 عزلة التي تم الحصول عليها، أُقيمت الدراسة على 131عزلة من بكتيريا الزائفة الزنجارية حيث تم إجراء إختبار تآزر القرص المزدوج ومن ثم تم فحصها لانتاج AmpCوعمل تفاعل البلمرة المتسلسل المتعدد. عند استخدام اختبار تآزر القرص المزدوج، لم تُظهر أي من العزلات فرقاً بمقدار ≥ 5 مم بين القطر الناتج من cefotaxime/clavulanic acidوذلك الناتج منcefotaximeوحده. مع ذلك، تم تحديد جميع العزلات على أنها منتجة لAmpC باستخدام الفحص الكاشف عنه. عندما تم استخدام تفاعل البلمرة المتسلسل المتعدد، ستة وستون عزلة (50.38%) كانت تؤوي جيناً واحداً على الأقل من ESBL. جين blaCTX-M كان الأكثر شيوعاً بين العزلات سواء منتج بمفرده (59.1%) أو بالاشتراك مع الجين blaSHV (37.88%). blaTEM كان الأقل اكتشافاً؛ لم يتواجد لوحده في أي من العزلات ولكن فقط في عزلة واحدة مع جين blaSHV. ومع ذلك، لم يكن هناك تواجد للثلاث جينات مجتمعة في عزلة واحدة. عزلات بكتيريا الزائفة الزنجارية المنتجة لانزيمات ESBL المأخوذة من المرضى المقيمين كانت أكثر من تلك المأخوذة من مرضى العيادات الخارجية. إضافة إلى ذلك، العزلات من أقسام الجراحة وعينات البلغم كانت تحتل الغالبية العظمى. الكوليستين، والأميكاسين، والجينتامايسين كانت العلاجات الأكثر فعالية ضد عزلات بكتيرياالزائفة الزنجارية المنتجة لانزيمات ESBL حيث أن 100% ، 91.9% و 89.18% من العزلات المنتجة لانزيمات ESBLأظهرت حساسيتها لهذه االمضادات الحيوية على التوالي. الخلاصة: توحي نتائج الدراسة بوضوح أن معدل بكتيرياالزائفة الزنجارية المنتجة لانزيمات ESBLفي تزايد ويعتبر سبب مهم للعدوى المرتبطة بالرعاية الصحية. لم يتم الكشف عن أي من العزلات بواسطة اختبار تآزر القرص المزدوج وقد يكون السبب هو انتاج انزيم البيتا لاكتاميز AmpCمن قبل جميع العزلات المُختبرة والذي قد يعيق أو حتى يُخفي الكشف عن انزيماتESBL باستخدام طرق النمط الظاهرية وهكذا يجب تضمين اكتشافAmpCفي اختبار الحساسية الروتيني للمضادات الحيوية لبكتيريا الزائفة الزنجارية. اما تفاعل البلمرة المتسلسل المتعدد فلقد نجح في الكشف عن جينات ESBLالمستهدفة. الكلمات الدالة: بكتيريا الزائفة الزنجارية المنتجة لانزيمات ESBL، اختبار تآزر القرص المزدوج، تفاعل البلمرة المتسلسل المتعدد، blaCTX-M، blaSHV، blaTEM، جينAmpC، الكوليستين، والأميكاسين، والجينتامايسين.
  • Thumbnail Image
    Item
    Develpoment of PCR systems for detection of Taeniidae family species
    (Al-Quds University, 2020-06-03) George Samir Farah Kokaly; جورج سمير فرح كوكالي
    Echinococcosis, caused by the larval stage of tapeworms of the genus Echinococcus, is one of the most important zoonotic diseases worldwide. Echinococcus granulosus and Echinococcus multilocularis are the most prevalent species infecting humans, resulting in cystic echinococcosis (CE) and alveolar echinococcosis (AE), respectively. In this study we investigated the presence of E. granulosus-specific DNA in dog’s feces by detecting the 18s r-DNA and cytochrome C oxidase I (cox1) mitochondrial gene, beside a repetitive E. granulosus DNA segment. From the total of seven PCR systems that were designed to amplify E. granulosus DNA that could be found in infected dog fecal samples only three systems were proved to be effective for this purpose. The three PCR systems were adapted first to amplify DNA from other cestode species of Taenidae family to be used in next generation DNA sequence analysis. The details of the PCR systems were as follow: PCR system 1 and 2 were based on universal primers from 18s rDNA gene, and amplified a DNA segment of 224bp and 216 bp respectively. PCR 3 based on E. granulosus repetitive region and amplified a region of 152 bp. PCR sensitivity test of the three candidate PCR systems was done, the sensitivity limit was 0.0025 ng/ml of E.granulosus genomic DNA. The three PCR systems were used to detect the presence of E. granulosus in 50 dog fecal samples collected from Yatta town, the produced amplicons were subjected to NGS MiSeq DNA analysis. A bioinformatics workflow was developed through Galaxy/europe online software for identifying E. granulosus specific sequences from thousands of obtained sequences for each sample. PCR system 1 proved to be the most effective and it detected target DNA in 12 from a total of 50 fecal samples (24%). This study will support future research that should reveal a better understanding of the Echinococcus-host interplay, and suggests new avenues for the identification of additional targets for diagnosis and chemotherapy.
  • Thumbnail Image
    Item
    Evaluation of Western blot analysis for the detection of COVID-19 infected and vaccinated serum samples against different viral specific antigen preparations
    (Al-Quds University, 2023-01-15) Aseel Basem Sami Eqneiby; أسيل باسم سامي اقنيبي
    مقدمة:فيروس كورونا هوعبارة عن فيروس يصيب الجهاز التنفسي ويطلق عليه اسم المتلازمة التنفسية الحادة (SARS-Cov-2) , ينكون هذا الفايروس من جينوم RNA أحادي موجب الاتجاه (+ ssRNA) حيث يترواح حجمه بين ال 30 و ال 32 كيلو بايت تتضمن مجموعة من البروتينات السطحية والوظيفية , يقوم فيروس كورونا ب احداث المرض والوصول الى خلايا الجسم من خلال ارتباطه بالخلايا السطحية المعروفة ب اسم ACE2 والموجودة في خلايا الرئة , الهدف الرئيسي من هذه الدراسة هو استخدام الانتيجينات المختلفة لفيروس كورونا و التي تم الحصول عليها مخبريا لفحص وجود لاجسام المضادة داخل مجموعة من العينات الماخوذة من مجموعات مختلفة من المرضى ب استخدام تقنية ال Western-blot الطريقة: تم استخدام مجموعة من ال plaques تسمى ال M13 phase plaquesوالتي تحتوي على 12 منطقة من الاحماض الامينية ضد مجموعة من الامصال الإيجابية المجمعة ل مرضى COVID-19, تم استخدام مجموعتان من ال 12 amino acids والبروتينات المصنعة في تحليل ال Western-blot, كانت الاصال المستخدمة في هذه الدراسة ثلاثة أنواع : (20 عينة مصل COVID-19 موجبة ومطعمة ، 10 عينات مصل إيجابية غير ملقحة ، وبعض عينات المصل السلبية). استنتاج النتائج: بشكل عام استخدام phages M13 التي تحتوي على 12 حمضًا أمينيًا تم اختيارها باستخدام الأمصال المصابة بفيروس COVID-19 ؛ ثبت أنه أكثر تفاعلًا مع عينات مرضى ال COVID-19 المحصنة وحتى المصابة وغير الملقحة ، وهذا مقارنة باستخدام مستضدات البروتينات المؤتلف السنبلة ال s protein أو الغشائية ال m protein . وقد لوحظ بوضوح أن هذه الانتيجينات المختلفة لم تتفاعل سوى مع IgG وليس IgM ، مما يشير إلى فائدتها في الكشف عن الحالات التي تحتوي على عيارات عالية من الأجسام المضادة IgG وليس في حالات عدوى COVID-19 الحادة. يمكن أن تؤكد هذه النتيجة على إمكانية استخدام phages M13 التي تحتوي على 12 من الأحماض الأمينية في تقييم إجراءات التطعيم ضد COVID-19.
  • Thumbnail Image
    Item
    Genotyping of Human Erythrocyte Antigens for Safe Blood Transfusion in Thalassemia Patients
    (Al-Quds University, 2022-05-23) Dorgam Muffed Ibraheem Yasin; ضرغام مفيد ابراهيم ياسين
    Management of β-thalassemia is a major challenge, especially in low resource countries. Blood transfusion is the mainstay treatment of patients with β-thalassemia major. However, blood transfusion is associated with several side effects including hemolytic and allergic reactions, iron overload, and transfusion-transmitted diseases. In this study, we assessed the biochemical, hematological, and hormonal parameters, estimated the prevalence of complications, studied the frequency of red blood cell alloimmunization and autoimmunization, and determined the genotype frequencies of blood group systems among transfusion-dependent β-thalassemia patients in the West Bank. Methods This study was conducted using 100 frequently transfused thalassemia patients. The patients were recruited through Thalassemia Daycare Units in five governmental hospitals patients with the highest transfusion frequency were selected for this study. A questionnaire was used to collect data regarding the basic characteristics of the patients. In addition, medical records were used to collect data regarding the complications of thalassemia among the patients. Blood samples were collected from the patients to measure biochemical, hematological, and hormonal parameters, in addition to screening and identification of antibodies and for DNA extraction. DNA samples were genotyped for Rhesus, Kell, Duffy, Kidd, MNS, Dombrock, Colton, Cartwright (Yt), Lutheran, Knops, Deigo, and Vel blood groups. Genotyping for blood groups was performed by sequence-specific primers (SSP)-PCR method. Results A total of 100 patients were included, 51% were males. The mean age among the patients was 21.9±10.9 years. The majority of the patients (60%) were recruited from Al Watani Hospital. The mean pre-transfusion hemoglobin level was found to be 7.89±0.99 g/dL and the mean serum ferritin level was 3670.42±3742.71 ng/dL. The results of liver function tests showed that 32%, 42%, and 34% had elevated ALT, ALP, and AST levels, respectively. Regarding the hormonal results,10% of the patients had subclinical hypothyroidism. The prevalence of growth hormone deficiency was 8%. Also, 8% of the patients had hypocalcemia and 70% had vitamin D deficiency. Elevated glucose levels were found among 15% of the patients. The most encountered complications were arthropathy (44%), hypogonadism (16%), and hepatic failure and delayed growth (7%). The genotyping results of the RHD blood group showed that 88% of the patients were RHD-positive whereas 7% were RHD-negative and 5% had no clear results. The allele frequencies of RHCE alleles were 0.440 and 0.560 for RHCE*C and RHCE*c, respectively, and 0.165 and 0.835 for RHCE*E and RHCE*e, respectively. Unexpectedly, for the Duffy blood group system, the null genotype (FY*02N.01/02N.01) was observed in 46% of the patients and the allele frequencies of FY*01 and FY*02 were 0.195 and 0.345, respectively. Furthermore, the allele frequencies of GYPA*M and GYPA*N were 0.585 and 0.405, respectively, and those of GYPB*S and GYPB*s were 0.275 and 0.725, respectively. The KEL*02, KEL*04, and KEL*07 allele frequencies were high among the patients in this study (0.920, 0.985, and 0.980, respectively). Furthermore, the allele frequencies of YT*A, LU*02, CO*01, KN*01, DI*B, DI*02.04, and VEL*01 were 0.940, 0.990, 0.990, 1.000, 0.980, 1.000, and 0.990. In addition, 2% of the patients had the Vel*01/-0.1 (Vel/Velnull) genotype. The rate of alloimmunization among patients was 8% and the most common antibodies were anti-E, anti-K and anti-D, and anti-C, respectively. The rate of autoimmunization was 5%. Conclusions The management of thalassemia should be based on internationally established guidelines. Understanding the frequencies of the major blood group systems other than the ABO and Rh systems is essential to provide accurate information regarding the local population’s requirements, reduce transfusion-related complications among frequently transfused patients, and facilitate the challenging task of providing antigen-negative blood for patients with multiple antibodies. Phenotyping of patients’ RBCs could have prevented the development of alloantibodies against Rh antigens C, E, and K. Furthermore, accurate testing for weak RhD among donors could also prevent alloimmunization against RhD antigens. The genotype and the allele frequencies observed among the sample of this study revealed several interesting findings that prompt further research. Keywords Alloimmunization, red cell genotyping, iron overload, beta-thalassemia, frequently transfused
  • Thumbnail Image
    Item
    Human Parvovirus B19 Epidemiology, Genotyping, Patients’ Hematological Presentation and Clinical Manifestations in Children in Southern Palestine
    (Al-Quds University, 2023-09-03) Miral Munther Badawi Abdo; ميرال منذر بدوي عبده
    Background: Human parvovirus (B19V) is a virus that is usually asymptomatic in healthy patients but can sometimes be symptomatic, especially in patients who have a previous underlying disease such as hematological and cardiopulmonary diseases. B19V targets the erythroid progenitor cells by attaching to the P antigen causing slapped cheek syndrome and may cause transient aplastic anemia. The aim of the study was to check the prevalence of B19V, the most common genotypes, its effect on CBC and the clinical symptoms especially transient aplastic crisis for the first time in Palestine. Methods: B19V was studied in children retrospectively from February 2014 to December 2022 in Caritas baby hospital in Bethlehem. Real-Time PCR for B19V was done on blood EDTA tube for 905 suspected patient samples out of which 28 patients tested positive for B19V (3%). The 28 B19V cases were compared with 32 B19V negative controls. Both groups were checked for social demographics, clinical symptoms, hematological parameters (CBC), and other lab tests (CRP, AST, and ALT). Moreover, genotyping was attempted on all RT-PCR positive B19V cases. This was done by amplifying B19V VP2 gene using VP2 special primers followed by Sanger sequencing. Results: As for social demographics, being a female or a male does not affect the chance of being infected with B19V, in addition to the age of the patient and the place of inhabitant. Regarding clinical manifestations some variables showed significant statistical association with B19V infection such as respiratory problems (p =0.046), malaise (p =0.005), and neurological issues (p =0.043); however, having fever, rash and anemia did not have any statistically significant association with B19V although 2 patients had severe anemia: one patient was diagnosed with pure red cell aplasia and another patient was diagnosed aplastic anemia. A statistically significant association was also found in certain CBC parameters, including WBC (p =0.003), platelets (p =0.018) and Hb (p =0.019, OD=9.6, 95% confidence interval: 1.45,63.5), notably patients with Hb < 10 mg/dl are 9.6 times more likely to test positive for B19V compared to Hb>10. CRP, AST, and ALT had no significant association with B19V, although all the B19V positive patients had CRP above 6 mg/dl. Of the patients analyzed, 40.7% of the cases had previous underlying disease which was significantly associated with B19V infection (p =0.003, OD=10.3, 95% confidence interval: 2 ,52.3), thus individuals with a previous underlying disease are 10.3 times more likely to test positive for the B19V compared to previously healthy patients. Moreover, 37% of the cases had coinfections of B19V and another microorganism. As for genotyping, of the 28 positive samples analyzed VP2 fragment was amplified from 5 samples (17.8%) that had high B19V viral load and the phylogenetic tree revealed that the most common genotype of B19V in Palestine is genotype 1.Conclusion: To conclude, this retrospective case-control study is the first study to check B19V in Palestine which provided valuable insights and more understanding about the virus in the country.
  • Thumbnail Image
    Item
    Identification of immunoreactive COVID-19 epitopes based on M13 phage display library
    (Al-Quds University, 2022-08-22) Tamer Ibrahim Issa Shabanah; تامر ابراهيم عيسى شبانه
    Background: COVID-19 is a contagious disease caused by sever acute respiratory syndrome coranavirus2 (SARS-COV2).arise in December, 2019 in Wuhan, China. Highly spreading rate of the virus lead to ongoing COVID-19 pandemic. Coronaviruses (COVs) are positive single stranded RNA (+ssRNA). Name of these sub-groping viruses coming from coranum (which mean crown), name are given due to the shape under electron microscope which reflect the appearance of spike glycoprotein on the envelope. , has affected over 2,164,111 people and killed more than 146,198 people in more than 200 countries throughout the world (1). Epitopes are the antigenic determinant part have the ability to recognize human cell receptor, spike protein can recognize Angiotensin converting enzyme 2 (ACE2) on epithelial cell surface and any cells that contain the receptor can be infected with COVID-19, on the same time immunity are produced against epitopes, for example antibodies produced against the virus to neutralize and opsonize COVID-19 virus, and this is what this study about. This study use M13 bacteriophage 12 amino acid peptide library, in which this bacteriophage are alternative for COVID-19 surface, and try to investigate which part of COVID-19 can be identified by human antibodies. Method: Phage display technique in general contain a library of sequences, these sequences represent peptide variants, study use 12.Amino acid library means that the segments or peptides are expressed on the N-terminal of p III contains a random amino acid sequence for selecting and binding with target molecule. Target molecule used in this study are serum of patient from Palestine, Hebron-west bank. All patient serum are confirmed that contain IGG antibody reactivity against COVID-19 antigen using Ag Rapid Test Device aboot. To increase the probability of antibodies screening and activity against phage library, a pooled serum from 13 patient are made. Before going to main reaction between the library and antibodies in serum, bacteriophage are amplified and enriched inside XLI-blue bacteria, XL1-blue bacteria are grown in LB medium and placed in LB broth then incubated at 37c overnight to reach log phase.5 minute incubation with bacteriophage and both placed inside pre-melted Top agar and pour them off together on previously made LB medium as a double medium. Reactive phages will be obviously seen. First reaction between phage library and serum of COVID-19 patient occur after taking a copy of amplified phages on Nitrocellulose membrane, membrane are blocked with 5%FCS for 30 minute, pooled serum then are added to react with phage library that coated Nitrocellulose membrane for 2-hours, washing unbounded phages away with PBS-T 3 times, Protein A then added and incubate 1-hour, remove unbounded with PBS-T 3 times, TMB substrate added to observe reaction for 30 minute. Positive clones are picked up for the next reaction, phage are purified by centrifugation at 14,000 for 5 minute, supernatant are taken then 20%PEG with 1/6 volume of 2.5M NACL added to supernatant in fresh tube, incubate overnight at 4c, next day phage are precipitated and appear as a white finger light pellet, precipitate are suspended with 100 micro/liter TBS, then suspension amplified in XL1-blue once again, amplified phage are spotted on NC membrane for the second time(<50 phage are spotted) in a method called Dot-ELISA, process in first reaction are repeated, 4 strong clones(clone1,clone 2,clone 4 and clone 9) are isolated, purified and amplified for third time in XL1-blue bacteria. Each clone (clone1, clone 2, clone 4 and clone 9) are distributed (coat) a 96-well plate, overnight incubation at 4c, all clones are blocked with 5%FCS, addition of 31 patient serum sample (each sample diluted 2 times (1:100 and 1:200)), washing three times, Protein A then added, washing and ABTS substrate are the last. -all reactive clones from three reactions are taken for DNA amplification, 2 primers Direct2 and Rev2 flanking peptide region and sized about 250bp are used on Thermocycler, PCR product are run on 2% Agarose gel electrophoresis then western blot for fused region on p III. Next generation sequencing illumine for all positive clones and result are aligned and BLAST on NCBI. Results: alignment showed that there's a massive repeat for DNA sequence insert (GATTATCATGATCCGAGTCTGCCTACGCTGCGGAAG) in phage 2-s376 for example are repeated more than 10,000 time (appendix). Same result confirmed that sequence (GATTATCATGATCCGAGTCTGCCTACGCTGCGGAAG) enriched in other phages; phage1-s361 repeated 1,483 times, phage 9-s378 repeated 2,083, phage4-s377 repeated 4,573 times (appendix). This result mean that this sequence are major content of the whole protein, so to ensure that, sequence then are translated to 12 amino acid query sequence, BLAST showed 57% identity in SARS-COV-2 epitopes, 8 identical amino acids are identical in NSP2, ORF1ab polyprotein and ORF1a. Conclusion: DNA repeat in clones shows strong reaction for local patient serum with peptide variants expressed in it is conformational fold fused with p III on the surface of M13 bacteriophage, positive clones reflect an epitope that may need more to be synthesized to become diagnostic rapid tool for investigation of positive IGG serum for SARS-COV-2 patient. ظهر فايروس كورونا المستجد في اواخر العالم 2019 حتى يومنا هذا,حيث يعتبر علامة فارقة في تاريخ البشرية الإنسانية, وقد سبب الفايروس العديد من الازمات في العالم وإغلاق كامل مناحي الحياة في كل العالم هذا وقد سبب العديد من الاصابات وحصد الأرواح, حيث اعتبرت منظمة الصحة العالمية هذا الفايروس على انه وباء ويجب على كل دولة في العالم تطبيق الخطط والبروتوكولات الخاصة بها لتفادي اكبر قدر ممكن من الاصابات.يسبب فايروس كورونا المستجد التهاب رئوي حاد سرعان ما يتطور ويسبب حالات تخثر الدم وجلطات تؤدي الى الوفاة وفي خضم ذلك تعتمد الاستجابة ضد الفايروس على مناعة المصاب ومدى تفاعل جهاز المناعة مع الفايروس,تشكل الامصال والاجسام المضادة مركز اهتمام في هذه الدراسة حيث تم اخذ امصال مرضى مصابين في فايروس كورونا من مستشفيات وزارة الصحة الفلسطينية وتم تحديد من خلال تقنية المكتبة الخاصة بفيروس الفاج M13 ماهية وترتيب البروتينات الخاصة بفايروس كورونا المستجد لدى المرضى. طرق البحث: تقنية المكتبة الخاصة بفيروس الفاج M13 ساهمت وبشكل كبير في اكتشاف السطح الخاص بفايروس كورونا المستجد لدى المرضى وذلك بعد المرور بالعديد من الخطوات التأكيدية لوجود الاجسام المضادة في امصال المرضى حيث تم الاستعانة بتقنية الاليزا النقطية والفحوصات المصلية, وبعد ان تم التأكد من وجود الامصال, كان لا بد من وضع الامصال مع المكتبة الخاصة بفيروس الفاج M13 المتواجد داخل بكتيريا خاصة لمضاعفته, بعد ذلك ظهرت نتائج الارتباط مع الامصال وبينت ماهية وترتيب البروتينات على سطح فايروس كورونا المستجد. النتائج: اظهرت النتائج الاولية تكرار احماض امينية في جميع الفاج M13 بكميات كبيرة,تم اخذ هذا الترتيب وترجمته الى بروتين بإستخدام ادوات علمية موثوقة حيث اظهر في نهاية ذلك ان هذا الترتيب من الاحماض الامينة يُظهر ويشير الى نوعين من البروتينات الموجودة على سطح الفايروس المستجد ما يثير الاهتمام ايضاً انه تم تكرار هذا الترتيب بكميات لا يمكن تجاهلها وقد تشكل النسبة الاكبر من البروتينات على سطح فايروس كورونا المتواجد لدى المرضى في فلسطين. الاستنتاج: تُشكل الدراسة للبروتينات لدى مرضى مصابين في البلاد امراً مهماً لمعرفة ماهية وطبيعة الفايروس لمعرفة كيف يمكن للفايروس ان يهاجم جسم المرضى, تكرار الاحماض الامينية بتقنية فايروس الفاج M13 اظهرت نتائج مقبولة علمياً قد تتطور لتُعطي فحصاً خاصاً يكشف عن وجود الفايروس داخل البلاد.
  • Thumbnail Image
    Item
    Identification of immunoreactive COVID-19 epitopes based on M13 phage display library
    (Al-Quds University, 2022-08-22) Tamer Shabana; تامر ابراهيم عيسى شبانه
    مقدمة: ظهر فايروس كورونا المستجد في اواخر العالم 2019 حتى يومنا هذا,حيث يعتبر علامة فارقة في تاريخ البشرية الإنسانية, وقد سبب الفايروس العديد من الازمات في العالم وإغلاق كامل مناحي الحياة في كل العالم هذا وقد سبب العديد من الاصابات وحصد الأرواح, حيث اعتبرت منظمة الصحة العالمية هذا الفايروس على انه وباء ويجب على كل دولة في العالم تطبيق الخطط والبروتوكولات الخاصة بها لتفادي اكبر قدر ممكن من الاصابات.يسبب فايروس كورونا المستجد التهاب رئوي حاد سرعان ما يتطور ويسبب حالات تخثر الدم وجلطات تؤدي الى الوفاة وفي خضم ذلك تعتمد الاستجابة ضد الفايروس على مناعة المصاب ومدى تفاعل جهاز المناعة مع الفايروس,تشكل الامصال والاجسام المضادة مركز اهتمام في هذه الدراسة حيث تم اخذ امصال مرضى مصابين في فايروس كورونا من مستشفيات وزارة الصحة الفلسطينية وتم تحديد من خلال تقنية المكتبة الخاصة بفيروس الفاج M13 ماهية وترتيب البروتينات الخاصة بفايروس كورونا المستجد لدى المرضى. طرق البحث: تقنية المكتبة الخاصة بفيروس الفاج M13 ساهمت وبشكل كبير في اكتشاف السطح الخاص بفايروس كورونا المستجد لدى المرضى وذلك بعد المرور بالعديد من الخطوات التأكيدية لوجود الاجسام المضادة في امصال المرضى حيث تم الاستعانة بتقنية الاليزا النقطية والفحوصات المصلية, وبعد ان تم التأكد من وجود الامصال, كان لا بد من وضع الامصال مع المكتبة الخاصة بفيروس الفاج M13 المتواجد داخل بكتيريا خاصة لمضاعفته, بعد ذلك ظهرت نتائج الارتباط مع الامصال وبينت ماهية وترتيب البروتينات على سطح فايروس كورونا المستجد. النتائج: اظهرت النتائج الاولية تكرار احماض امينية في جميع الفاج M13 بكميات كبيرة,تم اخذ هذا الترتيب وترجمته الى بروتين بإستخدام ادوات علمية موثوقة حيث اظهر في نهاية ذلك ان هذا الترتيب من الاحماض الامينة يُظهر ويشير الى نوعين من البروتينات الموجودة على سطح الفايروس المستجد ما يثير الاهتمام ايضاً انه تم تكرار هذا الترتيب بكميات لا يمكن تجاهلها وقد تشكل النسبة الاكبر من البروتينات على سطح فايروس كورونا المتواجد لدى المرضى في فلسطين. الاستنتاج: تُشكل الدراسة للبروتينات لدى مرضى مصابين في البلاد امراً مهماً لمعرفة ماهية وطبيعة الفايروس لمعرفة كيف يمكن للفايروس ان يهاجم جسم المرضى, تكرار الاحماض الامينية بتقنية فايروس الفاج M13 اظهرت نتائج مقبولة علمياً قد تتطور لتُعطي فحصاً خاصاً يكشف عن وجود الفايروس داخل البلاد.
  • Thumbnail Image
    Item
    “Identification of immunoreactive Toxoplasma gondii epitopes selected by high antibody titer positive human sera suitable for immunodiagnostic techniques”
    (AL-Quds University, 2016-12-22) دينا نبيل خليل زيغان; Dina Nabil Khalil Zighan; إبراهيم عباسي; د. رسمي أبو حلو; د. سمير برغوثي; د. شيفاء العملة
    Toxoplasma gondii is a coccidian obligatory intracellular protozoan parasite that utilizes cats as a definitive host and it is the causative agent of the toxoplasmosis (Abu-Madi, Behnke et al. 2008). The parasite affect about 30% of human population and it is considered a major zoonotic disease. (Chunlei Sua, Zhou et al. 2012; R. Edelhofer 2010) The disease is endemic in many countries in the world including Europe, United States and Mediterranean regions. The present study was conducted to identify immunoreactive Toxoplasma gondii epitopes using M13 phage display library for identifying peptides that mimic Toxoplasma gondii antigens. Phage display was done by plaque assay in 12 amino acid peptide phage library. For phage screening purposes; sera were collected from Toxoplasma gondii infected pregnant women, high antibody titer sera were pooled from different patients after screening for anti-Toxoplasma crude antigens by Modified Agglutination Test (MAT). By the aid of the high antibody titer Toxoplasma gondii pooled sera, three screening cycles of M13 phage display library, (12 amino acids peptides) were achieved. In the third screening cycle; 329 reactive plaques were obtained, 138 plaques that gave the strongest signals with pooled sera were selected for further analysis. Reactive peptides were isolated and sub-cloned in recombinant expression plasmid and were used in dot-ELISA to screen the selected M13 phage clones with pooled sera. ELISA test was also carried out to detect Toxoplasma infected individuals were identified. Phage Dot-Blot assay standardized for the confirmation of reactivity selected M13 phage clones with Toxoplasma gondii high antibody titer pooled sera and ELISA Assay revealed reactivity between selected amplified phages and some collected sera of Toxoplasma gondii infected individuals. The DNA coding the 12 amino acid peptide fused with the PIII M13 phage gene was amplified using specific primers flanking the peptide designed based on the PIII gene. DNA sequence was determined for 24 different clones, followed by bioinformatics DNA analysis by means of DNA alignment and BLAST search analysis. From the 24 sequenced peptides, 19 selected peptide clones represent the selected M13 phages showed no direct similarity to Toxoplasma gondii parasite DNA genomic sequences. So, due to that we was searching on amino acids sequence for the selected M13 phages through BLAST program. Data analysis showed a cross-reactivity between the selected M13 phages and anti-Toxoplasma pooled sera; which the sequences represent the selected M13 phages related to protozoan parasites such as Plasmodium knowlesi and Plasmodium fragile. These protozoan parasites are closely related to Toxoplasma family (Sarcocystidae). The selected M13 phage clones were pooled and tested for their reactivity against pooled anti-Toxoplasma sera in dot-blot and ELISA format. The obtained results showed specific interaction that need further studies and evaluation for the use of these phages in future Toxoplasma diagnosis.
  • Thumbnail Image
    Item
    Investigating β-Thalassemia Major Cases Emerged After Obligatory Premarital Testing in Palestine
    (Al-Quds University, 2023-11-11) Mais Khader Yousef Al Shatleh; ميس خضر يوسف الشتلة
    β-Thalassemia major is a prevalent autosomal recessive disorder worldwide, affecting approximately 3-4% of the Palestinian population. Management of this condition poses significant challenges, particularly in resource-constrained settings. This study aims to investigate the factors contributing to the emergence of new cases of β-thalassemia major after the implementation of obligatory premarital screening, thereby informing strategies for prevention and intervention. Methods We conducted a cross-sectional case-series study that included all patients diagnosed with β-thalassemia born in or after 2010 in the West Bank. 69 eligible patients from 62 families were included in the study. The data used in this study were collected through a comprehensive questionnaire covering the demographic and medical information of each thalassemic child born after 2010 in the family, familial sociodemographic characteristics, background characteristics of the parents (fathers and mothers), premarital screening, and the knowledge, attitudes, and practices (KAP) of parents (mothers and fathers). In addition, we collected blood samples from 68 children and 62 parents for hematological assessment (complete blood count and hemoglobin electrophoresis). Results The largest proportion of emerging thalassemia cases were from the northern region and resided in rural localities. 71% of the cases were from families married before 2010. 56.5% of the parents reported undergoing premarital screening tests. The proportion of parents who underwent premarital screening differed significantly by type of locality, year of marriage, and age at marriage. In addition, investigating the self-reported results of the premarital screening tests of each couple, we have found that among 24 partners who did not get tested, 22 were married before 2010 and 19 had children with β-thalassemia major. Furthermore, among 12 couples who reported that the two partners were tested and were non-carriers, 4 couples had children with β-thalassemia major, 4 had children with sickle cell thalassemia, and 4 had children with thalassemia intermedia. Overall, the proportion of children with thalassemia major was lower by 20% among parents who married in/after 2010. On the other hand, comparison between the self-reported results of premarital screening and the results of the hematological assessment (mean capsular volume), a total of 24 out of 32 parents had discrepancies in their results. the hematological assessment also showed that 3 out of 62 parents had normal MCV, all of which had high HbS and were parents of children with sickle cell thalassemia. Also, 8 parents had both low MCV and high HbS and one parent had low MCV and high HbC and was a parent of two children with hemoglobin SC disease. Assessment of knowledge showed that all parents had adequate knowledge about thalassemia, 51.7% of the parents had poor overall attitudes, and 76.3% had poor attitude scores towards the termination of pregnancy. Furthermore, 47.4% of the parents had good overall practice scores. Knowledge scores were positively correlated with attitude scores (r=300; p-value=0.01) but not with practice scores (r=0.058; p-value=0.543). Attitude score towards prenatal diagnosis and overall practice scores were also positively correlated (r=0.271; p-value=0.003). Conclusions This study highlights the pressing need for proactive measures to address the prevalence of hemoglobinopathies in Palestine. Findings highlight the crucial role of Health Education and Awareness Programs, aimed at disseminating information about thalassemia, its inheritance patterns, and preventive measures. Additionally, the screening criteria should be revised to include screening for other hemoglobinopathies, and the screening must be performed in Designated Receptions Centers where trained staff perform and interpret the results in accordance with standard laboratory diagnostic protocols. Strengthening pre-marital counseling and screening services is imperative to ensure comprehensive coverage. Early detection, accurate carrier identification, and informed decision-making regarding marriage and family planning should be central in preventive efforts. Continuous training for healthcare professionals and community workers is crucial to effectively prevent and manage thalassemia.
  • Thumbnail Image
    Item
    Prevalence of Colistin Resistance Among Clinical Isolates of Enterobacteriaceae Family in Palestinian Hospitals
    (Al-Quds University, 2021-05-30) Tasnim Ali AbdelMunem Abu Sibaa; تسنيم علي عبد المنعم أبو سباع
    Background: Microbial resistance to antibiotic is an increasing global public health threats. Colistin are polycationic piptides antibiotics used as an effective traetment against multidrug resistant (MDR) gram negative bacteria mainly acting on lipopolysaccharide (LPS) and considred as one of the important antibiotics in human medicine despite its side effects and toxicity in some cases. Colistin resistance can be acquired by chromosomal mutations that affect the lipid A moiety of the lipopolysaccharide chain or by acquisition of MCR genes. Aims: The general aim of this study was to investigate the prevalence of colistin resistance among clinical Enterobacteriaceae isolates from Palestinian hospitals. In addition to identify Enterobacteriaceae spp that are resistant to colistin. A third aim, is to compare colistin susceptibility using the Disc Diffusion Method (DDM) in relation to the reference method; Broth Micro-Dilution Method (BMD). A fourth aim is to detect the plasmid coded gene (mcr-1) responsible for colistin resistance as a marker for colistin resistance. Methodology: A total of 80 bacterial isolates were collected from three hospitals in Palestine (AL-Makassed Hospital in Jerusalem, Al-Ahli Hospital and Alia Hospital in Hebron). The isolates were identified as Enterobacteriaceae and the speciation was done using Enterotube identification kit. The antimicrobial susceptibility testing for colistin was done by disc DD and BMD method. Furthermore, we used PCR reaction to detection of plasmid mcr-1 gene, which code for colistin resistance. Result: A total of 80 isolates were tested using DD and BMD method to determine the susceptibility of the clinical isolates to colistin. Only two isolates were colistin resistance one was Serratia marcescens and the other was Proteus mirabilis according to DDM results. However, when BMD method was used, ten (10) was identified; confirming the two isolates previously reported positive using DDM, the remaining were not detected by DDM. Escherichia coli was the most common organism among colistin resistance isolates (40%), followed by Proteus (20%), Serratia (20%), Enterobacter cloacae (10%) and Klebsiella pneumoniae (10%). Cifuroxime a beta lactum showed highest resistance (80%), followed by Ciprofloxacin a quinoone (55%). The most effective drug other than colistin, was Amikacin (80%) followed by v Gentamycin, Ertapenem, Merobenem and Tazobactum/Pipercillin (65%) respectively. All the colistin resistant isolates were tested negative for plasmid mcr-1 gene after amplification by PCR. Discussion: Colistin resistance is largely attributed to the PmrA-PmrB and PhoP-PhoQ regulatory systems and their responses to environmental changes. Resistance may also be Plasmid-mediated by the gene mcr-1. These limit and complicate treatment options of infection caused by Enterobacteriaceae in Palestinian Hospitals, which in turn calls for immediate actions to controlling and monitoring the use of antimicrobials in general and colistin in particular. Conclusion: High resistant rate was reported for colistin (12.5%) using BMD. Although, DDM was inexpensive and easy to perform, it failed to detect most of the colistin resistant isolates. BMD method was very reliable and gave excellent results although it is expensive and not routinely performed in the clinical microbiology laboratories. For plasmid detection using PCR, all the colistin resistant isolates tested negative for the mcr-1 gene, indicating that the cause of resistance could be physiologically or chromosomal mediated. Keywords: Drugs resistance, colistin antibiotic, plasmid mcr-1 gene, broth micro-dilution, Enterobacteriaceae family.
  • Thumbnail Image
    Item
    The Prevalence, Diagnosis, and Antifungal Susceptibility of Candida Species in Palestine
    (Al-Quds University, 2023-08-20) Hanaa Khairaldeen Mohammed Baniodeh; هناء خيرالدين محمد بنيعودة
    Background: Candida spp are the single most common cause of opportunistic fungal infection.Various healthcare implications are associated with Candida infections, including morbidity and mortality. The significantly increased occurrence of Candida species as human pathogens can be attributed to improved identification techniques. In Palestine, minimal data have been reported about Candida infection. Methods: We performed our study at two hospitals in Palestine ( Istishari Arab Hospital, and Najah National University Hospital ). All patients diagnosed with candidiasis during the year 2022 have participated in the study. The prevalence of Candida spp,their distribution and the activity of selected antifungals against Candida pathogens were statistically analyzed using Microsoft Excel Version (16.74). In combination with phenotypic properties, Candida isolates were identified and tested for antifungal susceptibility using the colorimetric VITEK-2 Compact system at two hospitals. Results : Our results showed that the prevalence of Candida spp among infected samples was 11.6%. Twelve different Candida spp were identified. Among these isolates, C. albicans (49.88%) was the most frequent, followed by C. glabrata (17.3%), C. tropicalis (14.83%), C. parapsilosis (5.16%), C. krusei (3.82%), C.auris(2.69%) ,C.dubliniensis (2.24%), C.ciferrii (1.79%) C.lusitaniae (0.89%), C. guilliermondii (0.67%), C.Kefyer (0.44%) and C.spherica(0.22%). Among C. albicans, all isolates were 100% susceptible to fluconazole, and micafungin .The susceptibility rates to Amphotericine B and flucytosine were 95 % and 99 % respectively. As a comparison, the susceptibility rates of non-albicans candida to fluconazole, voriconazole, amphotericine B, caspofungin ,flucytosine and micafungin were 70 %, 99 %, 97 %, ,72% , 92% and 100 %, respectively. Patients in the intensive care unit are more susceptible to candida infections than patients in other hospital departments. Conclusions: Four pathogens are responsible for the most invasive infections: Candida albicans, Candida glabrata, Candida tropicalis, and Candida parapsilosis. Those in an immunocompromised state are more likely to develop Candida infections. A notable characteristic of this study was the high frequency of non-albicans Candida Spp, which were often more resistant to antifungal agents. A quick and accurate system like Vitek 2 compact was suggested for careful species identification of clinical isolates of Candida. We suggest that continued surveillance of species distribution and susceptibility to antifungals will enhance future burden estimates and assist in evaluating preventative measures' effectiveness.
  • Thumbnail Image
    Item
    The Effect of Physiotherapy Intervention on Functional Outcomes among COVID19 patients at Governmental Hospitals in Hebron/Palestine
    (Al-Quds University, 2021-08-18) Athar Khalid Daher Abu Fara; اثار خالد ظاهر ابو فارة
    Background: COVID-19 is a highly contagious coronavirus that spread via large aerosol droplets or direct contact with infected secretion, as the novel virus enters the body it will leave dysfunctions in the whole body systems. The main cause of its increased mortality rate is pneumonia that rapidly progresses to acute respiratory distress. Physiotherapy is a health care profession involved in the management of many respiratory conditions; it plays a key role in the non-invasive support management, postural changes, chest physiotherapy, and bed mobility, in terms of COVID-19 there is scarce evidence about the effect of physiotherapy interventions on COVID-19 patients'. The aim of this study is to investigate the effects of physiotherapy intervention on functional outcome level among COVID -19 patients in the acute stage. Methods: This study is Quasi-experimental designs/ non-equivalent groups, targeted severe COVID-19 patients recruited from Hebron and Dura governmental hospitals of COVID- 19 departments by using Systematic random sampling, 54 male and 6 female, the mean age was 50 years. Intervention group (n=30) received 2 physiotherapy sessions/daily, consisting of positioning, chest physiotherapy, aerobic exercises, breathing exercises, and early mobility, while the control group received regular medical care only. Patients have been evaluated 2 times at the baseline and discharge using peripheral oxygen saturation, respiratory rate test, dyspnea rate, 2 minutes - walk test, and spirometer scores to test (FVC, FEV1). Results: The two groups showed significant improvements between the baseline and the discharge scores, however the intervention group achieved significant improvement in all outcome measures at the discharge (p < 0.05). Furthermore the gender, pre-exciting diseases, and increased BMI are general risk factors of the COVID- 19 severity, length of hospitalization. Conclusion: This study shows that physiotherapy management with COVID- 19 patients improved the oxygen saturation, respiratory rate, dyspnea, 2 - minutes – walk, and lung function tests (FVC, FEV1). Key words: Physiotherapy, COVID-19, Coronavirus, Severe Acute Respiratory Syndrome
  • Thumbnail Image
    Item
    استخلاص شامل وفحص النشاط الحيوي ضد الميكروبات لنبتة ببيليريوم سبوفاتوم: عضو من النباتات الفلسطينية
    (AL-Quds University, 2016-05-14) ايه علي أحمد القاضي; aya ali ahmad Ghanayem; محمود ابو حديد; Hateim Eideh; Nidal Jaradat
  • Thumbnail Image
    Item
    الاختلافات الوراثية في التسلسلات الجينية لمستقبلات البيورينرجك- P2Y12 بين الفلسطينيين والسويديين والكونغوليين.
    (AL-Quds University, 2017-11-18) محمد يوسف سعيد عسعيس; MOHAMMED YOUSEF SAED ASEES; رانية أبو سير; Dr. Camilla Hesse; Khalid Younis; Majdi Dwekat
  • Thumbnail Image
    Item
    الأخطاء النحوية والإملائية الشائعة لدى طلبة الصف الأول الثانوي في مديرية تربية جنوب الخليل, أسبابها وطرق علاجها
    (AL-Quds University, 2014-02-18) احمد محمد خالد جبرين; Ahmad M. K. Jebreen; أحمد فهيم جبر; مشهور حبازي; ياسر الملاح