Identification of immunoreactive COVID-19 epitopes based on M13 phage display library

Simple item page
creativework.keywordsimmunoreactive ,COVID-19en
dc.contributor.authorTamer Shabanaen
dc.contributor.authorتامر ابراهيم عيسى شبانهar
dc.date.accessioned2023-02-21T12:28:21Z
dc.date.available2023-02-21T12:28:21Z
dc.date.issued2022-08-22
dc.description.abstract مقدمة: ظهر فايروس كورونا المستجد في اواخر العالم 2019 حتى يومنا هذا,حيث يعتبر علامة فارقة في تاريخ البشرية الإنسانية, وقد سبب الفايروس العديد من الازمات في العالم وإغلاق كامل مناحي الحياة في كل العالم هذا وقد سبب العديد من الاصابات وحصد الأرواح, حيث اعتبرت منظمة الصحة العالمية هذا الفايروس على انه وباء ويجب على كل دولة في العالم تطبيق الخطط والبروتوكولات الخاصة بها لتفادي اكبر قدر ممكن من الاصابات.يسبب فايروس كورونا المستجد التهاب رئوي حاد سرعان ما يتطور ويسبب حالات تخثر الدم وجلطات تؤدي الى الوفاة وفي خضم ذلك تعتمد الاستجابة ضد الفايروس على مناعة المصاب ومدى تفاعل جهاز المناعة مع الفايروس,تشكل الامصال والاجسام المضادة مركز اهتمام في هذه الدراسة حيث تم اخذ امصال مرضى مصابين في فايروس كورونا من مستشفيات وزارة الصحة الفلسطينية وتم تحديد من خلال تقنية المكتبة الخاصة بفيروس الفاج M13 ماهية وترتيب البروتينات الخاصة بفايروس كورونا المستجد لدى المرضى. طرق البحث: تقنية المكتبة الخاصة بفيروس الفاج M13 ساهمت وبشكل كبير في اكتشاف السطح الخاص بفايروس كورونا المستجد لدى المرضى وذلك بعد المرور بالعديد من الخطوات التأكيدية لوجود الاجسام المضادة في امصال المرضى حيث تم الاستعانة بتقنية الاليزا النقطية والفحوصات المصلية, وبعد ان تم التأكد من وجود الامصال, كان لا بد من وضع الامصال مع المكتبة الخاصة بفيروس الفاج M13 المتواجد داخل بكتيريا خاصة لمضاعفته, بعد ذلك ظهرت نتائج الارتباط مع الامصال وبينت ماهية وترتيب البروتينات على سطح فايروس كورونا المستجد. النتائج: اظهرت النتائج الاولية تكرار احماض امينية في جميع الفاج M13 بكميات كبيرة,تم اخذ هذا الترتيب وترجمته الى بروتين بإستخدام ادوات علمية موثوقة حيث اظهر في نهاية ذلك ان هذا الترتيب من الاحماض الامينة يُظهر ويشير الى نوعين من البروتينات الموجودة على سطح الفايروس المستجد ما يثير الاهتمام ايضاً انه تم تكرار هذا الترتيب بكميات لا يمكن تجاهلها وقد تشكل النسبة الاكبر من البروتينات على سطح فايروس كورونا المتواجد لدى المرضى في فلسطين. الاستنتاج: تُشكل الدراسة للبروتينات لدى مرضى مصابين في البلاد امراً مهماً لمعرفة ماهية وطبيعة الفايروس لمعرفة كيف يمكن للفايروس ان يهاجم جسم المرضى, تكرار الاحماض الامينية بتقنية فايروس الفاج M13 اظهرت نتائج مقبولة علمياً قد تتطور لتُعطي فحصاً خاصاً يكشف عن وجود الفايروس داخل البلاد.ar
dc.description.abstractCOVID-19 is a contagious disease caused by sever acute respiratory syndrome coranavirus2 (SARS-COV2).arise in December, 2019 in Wuhan, China. Highly spreading rate of the virus lead to ongoing COVID-19 pandemic. Coronaviruses (COVs) are positive single stranded RNA (+ssRNA). Name of these sub-groping viruses coming from coranum (which mean crown), name are given due to the shape under electron microscope which reflect the appearance of spike glycoprotein on the envelope. , has affected over 2,164,111 people and killed more than 146,198 people in more than 200 countries throughout the world (1). Epitopes are the antigenic determinant part have the ability to recognize human cell receptor, spike protein can recognize Angiotensin converting enzyme 2 (ACE2) on epithelial cell surface and any cells that contain the receptor can be infected with COVID-19, on the same time immunity are produced against epitopes, for example antibodies produced against the virus to neutralize and opsonize COVID-19 virus, and this is what this study about. This study use M13 bacteriophage 12 amino acid peptide library, in which this bacteriophage are alternative for COVID-19 surface, and try to investigate which part of COVID-19 can be identified by human antibodies. Method: Phage display technique in general contain a library of sequences, these sequences represent peptide variants, study use 12.Amino acid library means that the segments or peptides are expressed on the N-terminal of p III contains a random amino acid sequence for selecting and binding with target molecule. Target molecule used in this study are serum of patient from Palestine, Hebron-west bank. All patient serum are confirmed that contain IGG antibody reactivity against COVID-19 antigen using Ag Rapid Test Device aboot. To increase the probability of antibodies screening and activity against phage library, a pooled serum from 13 patient are made. Before going to main reaction between the library and antibodies in serum, bacteriophage are amplified and enriched inside XLI-blue bacteria, XL1-blue bacteria are grown in LB medium and placed in LB broth then incubated at 37c overnight to reach log phase.5 minute incubation with bacteriophage and both placed inside pre-melted Top agar and pour them off together on previously made LB medium as a double medium. Reactive phages will be obviously seen. First reaction between phage library and serum of COVID-19 patient occur after taking a copy of amplified phages on Nitrocellulose membrane, membrane are blocked with 5%FCS for 30 minute, pooled serum then are added to react with phage library that coated Nitrocellulose membrane for 2-hours, washing unbounded phages away with PBS-T 3 times, Protein A then added and incubate 1-hour, remove unbounded with PBS-T 3 times, TMB substrate added to observe reaction for 30 minute. Positive clones are picked up for the next reaction, phage are purified by centrifugation at 14,000 for 5 minute, supernatant are taken then 20%PEG with 1/6 volume of 2.5M NACL added to supernatant in fresh tube, incubate overnight at 4c, next day phage are precipitated and appear as a white finger light pellet, precipitate are suspended with 100 micro/liter TBS, then suspension amplified in XL1-blue once again, amplified phage are spotted on NC membrane for the second time(<50 phage are spotted) in a method called Dot-ELISA, process in first reaction are repeated, 4 strong clones(clone1,clone 2,clone 4 and clone 9) are isolated, purified and amplified for third time in XL1-blue bacteria. Each clone (clone1, clone 2, clone 4 and clone 9) are distributed (coat) a 96-well plate, overnight incubation at 4c, all clones are blocked with 5%FCS, addition of 31 patient serum sample (each sample diluted 2 times (1:100 and 1:200)), washing three times, Protein A then added, washing and ABTS substrate are the last. -all reactive clones from three reactions are taken for DNA amplification, 2 primers Direct2 and Rev2 flanking peptide region and sized about 250bp are used on Thermocycler, PCR product are run on 2% Agarose gel electrophoresis then western blot for fused region on p III. Next generation sequencing illumine for all positive clones and result are aligned and BLAST on NCBI. Results: alignment showed that there's a massive repeat for DNA sequence insert (GATTATCATGATCCGAGTCTGCCTACGCTGCGGAAG) in phage 2-s376 for example are repeated more than 10,000 time (appendix). Same result confirmed that sequence (GATTATCATGATCCGAGTCTGCCTACGCTGCGGAAG) enriched in other phages; phage1-s361 repeated 1,483 times, phage 9-s378 repeated 2,083, phage4-s377 repeated 4,573 times (appendix). This result mean that this sequence are major content of the whole protein, so to ensure that, sequence then are translated to 12 amino acid query sequence, BLAST showed 57% identity in SARS-COV-2 epitopes, 8 identical amino acids are identical in NSP2, ORF1ab polyprotein and ORF1a. Conclusion: DNA repeat in clones shows strong reaction for local patient serum with peptide variants expressed in it is conformational fold fused with p III on the surface of M13 bacteriophage, positive clones reflect an epitope that may need more to be synthesized to become diagnostic rapid tool for investigation of positive IGG serum for SARS-COV-2 patient.en
dc.identifier.urihttps://dspace.alquds.edu/handle/20.500.12213/8045
dc.language.isoen_US
dc.publisherAl-Quds Universityen
dc.titleIdentification of immunoreactive COVID-19 epitopes based on M13 phage display libraryen
dc.titleاستكشاف الخارطة الجينية لسطح فايروس SARS-CoV-2 بإستخدام امصال مرضى الفايروس بتقنية المكتبة الخاصة لفايروس الفاج M13ar
dc.typeThesis
Files
License bundle
Now showing 1 - 1 of 1
Thumbnail Image
Name:
license.txt
Size:
1.61 KB
Format:
Item-specific license agreed upon to submission
Description:
Download
Collections
Medical Laboratory science